Intro to linked-read data

What you ought to know about linked reads

Harpy was originally tailor-made for haplotagging linked read data, but now it works for most linked-read technologies along with non-linked read data. BRL/LRTK/LongRanger are similar pieces of software for Tellseq, stLFR, and 10X linked-read data. But, what if you don't use linked reads (yet) and want to understand what it actually is? This post walks you through what linked-read data is and some of the concepts that are unique to it that makes it different than your typical short-read data.

  • a cup of tea, coffee, or water
  • a can-do attitude

Linked reads

Let's start with the most obvious, what are linked reads, which are sometimes called "synthetic long reads"? They are short read (e.g. Illumina) data. What makes them different is that they contain an added DNA segment ("barcode") that lets us associate sequences as having originated from a single DNA molecule. That means if we have 4 sequences that all contain the same added barcode, then we infer that they must have originated from the same original DNA molecule. Different barcode = different molecule of origin. If the sequences would map to the same genomic region during sequence alignment, we would know that those sequences with the same barcode originated from a single DNA fragment from a single homologous chromosome from a single cell. That's right, built-in phase information.

simplified overview of linked reads
simplified overview of linked reads

What do they look like?

Linked-read data is sequence data as you would expect it, encoded in a FASTQ file. The first processing step of linked-read data is demultiplexing to split the raw Illumina-generated batch FASTQ file into samples (if multisample) and identify/validate the linked-read barcode on every sequence. For 10X data, the barcode would stay inline with the sequence (to make it LongRanger compatible), but for other varieties (haplotagging, stLFR, etc.) you would also remove the barcode from the sequence and preserve it somewhere in the read header. The demultiplexing process is generally similar between non-10X linked-read technologies: a nucleotide barcode sequence gets identified and moved from the sequence line to the read header with some kind of platform-specific notation. The diagram below preserves the nucleotide barcode under the OX:Z tag and recodes it under BX:Z using the haplotagging "ACBD" segment format, however it would also be valid to just keep the nucleotide barcode under BX:Z. Linked-read software is variable in its flexibility towards barcode formatting. 10X linked read data before and after demultiplexing

Deconvolution

There are approaches to deconvolve linked read data (or "deconvolute", if you're indifferent to the burden of an extra syllable). In this context, deconvolution is finding out which sequences are sharing barcodes by chance rather than because they originated from the same DNA molecule. The likelihood of it happening is usually low, but it's not impossible. When the algorithm determines that barcodes are being shared by unrelated molecules, the barcode typically gets suffixed with a hyphenated number (e.g. BX:Z:ATACG becomes BX:Z:ATACG-1). As of this writing, there are only a few pieces of software that can deconvolve linked-read data and do so with varying degrees of success and computational resource requirements. Similarly, linked-read software is variable in its flexibility towards accepting the deconvolved-barcode format.

Linked-read varieties

There are a handful of linked-read sample preparation methods (read below), but that's largely an implementation detail. All of those methods are laboratory procedures to take genomic DNA and do the necessary modifications to fragment long DNA molecules, tag the resulting fragments with the same DNA barcode, then add the necessary Illumina adapters. It's not unlike the different RAD flavors (e.g. EZrad, ddRAD, 2B-rad)-- they all give you RAD data in the end, but vary in how you get there in terms of cost and bench time. We obviously subscribe to haplotagging 😁.

Failsafe

Unlike some other fancy well-touted sample preparation methods (cough cough mate-pair), linked-read data is whole genome sequencing (WGS). What that means is that whether you use the linked-read information or not, the data will always be standard and viable WGS compatible with whatever you would use WGS for. It's WGS, but with a little extra info that goes a long way.

Linked-read library performance

Because linked-read data has an extra dimension, there are some additional metrics that are useful to look at to evaluate how "good" the linked-read library turned out. As a baseline for comparison, think of RAD or WGS data and the kinds of metrics you might look at for library performance:

  • coverage depth
  • coverage breadth
  • PCR/optical duplicates
  • coverage depth per sample

Linked-read library performance also looks at that, but there's a few extra parameters that help us assess performance:

Molecule Coverage

Since linked reads are tagged per DNA molecule, we are interested in understanding coverage on a per-molecule basis. By "molecule", we are referring to the original DNA molecule from which barcoded sequences originated from.

reads per molecule

It's quite rare that all fragments of a single DNA molecule will get sequenced, so we are interested in getting an average number of reads (sequences) per original DNA molecule. This is done by getting counts of all the reads with the same barcode, as unique barcodes correspond with unique DNA molecules. It's difficult to say exactly what a good number of reads per molecule would be, but >2 would be a good starting point (1 would be a singleton, see below). Having 3-6 would be decent, depending on your project goals.

percent molecule coverage

Because only a few fragments from a DNA molecule end up getting sequenced, it would be good to understand how much of a molecule is represented in seqences (breadth). It's impossible to get an accurate calculation for this metric because we have no way of knowing the size of the original DNA molecule, but what we can do is, after alignment, find the distance between the two furthest reads sharing a barcode and calculate how many bases between them have been sequenced. It's not perfect, but it's something. A low number would indicate large gaps between linked sequences (e.g. few sequences and/or a very large molecule), whereas a high number would indicate small gaps between linked sequences (e.g. many sequences and/or a very small molecule).

molecule coverage example for 3 linked-reads sharing the same barcode
molecule coverage example for 3 linked-reads sharing the same barcode

Singletons

Because linked reads need to be, well, linked, we need to know exactly how many of the sequences actually share barcodes. A barcode that only appears in one paired or unpaired read is a singleton, meaning it isn't actually linked to any other sequence. Despite having a linked-read barcode, the absence of other reads with the same barcode means the barcode information for that read (or read pair) is mostly useless, aka it's just a plain-regular short read and can be used as such. Having <60% would be considered decent, but you would want as few singletons as possible in a linked-read dataset. For perspective, if 90% of your reads were singletons, you can think of that as "90% of your data aren't linked reads". The opposite of a singleton is when a barcode is shared by more than one paired or unpaired read, aka a linked read.

singletons and linked reads
singletons and linked reads

Linked Coverage

Because of the "linked" component of linked-read data, we have an additional kind of sequence coverage to consider, which is linked coverage. Since linked-read barcodes preserve long-distance information, we can do an alternative kind of coverage calculation where you pretend that all the sequences with a shared barcode are one big gapless sequence. If you use your imagination that way, the name "synthetic long reads" begins to make more sense. Mathematically, the linked coverage (breadth and depth) should always be higher than the coverage from just the alignments themselves, as gaps between linked reads are counted as well. If you see that your linked depth is unusually high (e.g. the aligmment depth is 20 and linked depth is >1000), then it's very likely your have barcode clashing that has not been deconvoluted. In other words, reads from different DNA molecules that are sharing a barcode are mapped very far from each other and inflating the depth values for everything in between.

linked depth
linked depth

In real data, this actually looks very cool. Below is a graph from the per-sample alignment report Harpy generates. It's a circos plot, which is a circular representation of round charts, and each wedge is a chromosome (start to finish), labelled by the "2R", "2L", etc. around the perimeter. The inner circle (grey histogram) is the sequence alignment depth (i.e. the standard depth calculation) and the outer circle (magenta histogram) is the linked depth of those same data in those same 50kbp intervals. It has the most fascinating flower petal pattern, which is due to the lower likelihood of reads linking at the edges of chromosomes.

linked depth in real data
linked depth in real data

Linked-read data types

This isn't really the place to go into the nitty-gritty of the different linked-read chemistries (i.e. I don't actually know the nuanced details), but it's worth describing the obvious differences of the raw (FASTQ) data. Knowing these details might help you make sense of compatibilties/incompatibilities for software, or how you can convert between styles.

Type Location Format Invalid Encoding Example
Standard BX:Z and VX:i tags any VX:i:0 BX:Z:31_442_512 VX:i:1
Haplotagging BX:Z tag ACBD 00 segment BX:Z:A04C54B96D11
stLFR end of sequence ID #1_2_3 0 segment @A003432423434:1:324#12_432_1
TELLseq end of sequence ID :ATCG N @A003432423434:1:324:TTACCACGAGG
10X R1 read ATCG N AGGTTGGGTAAGATA...

We here at Harpy would like to plead for linked-read practitioners to adopt a standardized representation of linked-read barcodes. We don't really care what linked-read technology you use (although we obviously prefer haplotagging), but we do care about the data formats being consistent. The classic joke in population genetics is that before you write a new piece of software, you need to first write a new file format. We really don't want that here-- inconsistent linked-read data formats make it harder for developers to write great software that is compatible with all linked-read data types when they need to account for every possible location a barcode could be in, what a valid vs invalid barcode looks like for that technology, etc. So, we are humbly asking (nay, begging) for there to be a standard data format (FASTQ and SAM/BAM) that uses two SAM tags to encode barcodes:

"Standard" linked-read FASTQ format
"Standard" linked-read FASTQ format

  • BX:Z tag to record the barcode, the format of which is irrelevant
    • it could be haplotagging ACBD, stLFR 1_2_3, nucleotides, whatever
  • VX:i tag to record if the corresponding barcode is valid
    • 0 is invalid
    • 1 is valid

This format makes it the responsibility of the early data processing software (as early as demultiplexing) to encode the data in this format for downstream processing. Our hope is that this htslib-compliant format is adopted to reduce the fragmentation in the software ecosystem and reduce the need for file format conversions. It also creates a blueprint for a generic file encoding for any new linked-read methods that are being developed or can be developed in the future.

stLFR style FASTQ header (valid barcode)
@A00470:481:HNYFWDRX2:1:2101:29532:1063/1 BX:Z:45_11_361 VX:i:1
haplotagging style FASTQ header (invalid barcode)
@A00470:481:HNYFWDRX2:1:2101:29532:1063/1 BX:Z:A78C00B14D96 VX:i:0
haplotagging style SAM record (valid barcode)
A00470:481:HNYFWDRX2:1:2229:29912:29778 99      2R      1222    40      19S80M  =   1500     428     AGATGTGTATAAGAGACAGAGTTATGTCATTTTAAGCGGTCAAAATGGGTGAATTTCCGATTTCAAGTAATAGGCGAACTCAAGATACCTTCTACAGAT  FFFFFFFFFFFFFFFFF:FFFFF:FFFFF:FFFF:FFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:,FFFFFFF:FFFFF  NM:i:0  MD:Z:80 MC:Z:150M       AS:i:80      XS:i:80 RG:Z:sample1    MI:i:1  VX:i:1  BX:Z:A55C67B91D96
nucleotide (TELLseq/10X) style SAM record (invalid barcode)
A00470:481:HNYFWDRX2:1:2229:29912:29778 99      2R      1222    40      19S80M  =   1500     428     AGATGTGTATAAGAGACAGAGTTATGTCATTTTAAGCGGTCAAAATGGGTGAATTTCCGATTTCAAGTAATAGGCGAACTCAAGATACCTTCTACAGAT  FFFFFFFFFFFFFFFFF:FFFFF:FFFFF:FFFF:FFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:,FFFFFFF:FFFFF  NM:i:0  MD:Z:80 MC:Z:150M       AS:i:80      XS:i:80 RG:Z:sample1    MI:i:1  VX:i:0  BX:Z:TACANNNCACAGAG

Unlike the available chemistries, haplotagging is non-commercial (DIY!!). Haplotagging barcodes are combinatorial and are made up of four 6bp segments. Two of these segments ("A" and "C") are the first 12bp of the I1 read and the other two ("B" and "D") are the first 12bp of the I2 read, both of which are provided by Illumina for standard sequencing runs. Because of this segment design, there are 96^4 (84 million) possible barcode combinations (900,000 per sample). The barcodes are stored in the sequence header under the BX:Z SAM tag, recoded in their "ACBD" format.

Haplotagging data format
Haplotagging data format

  • 4 barcode segments
    • A segment is the first 6bp of the I1 read
    • C segment is the next 6bp of the I1 read (7-12)
    • B segment is the first 6bp of the I2 read
    • D segment is the next 6bp of the I2 read (7-12)
  • barcode stored as BX:Z tag in the read header in ACBD format
    • e.g. @A003432423434:1:324 BX:Z:A45C01B84D21

Another of the presently available commercial linked-read options. stLFR data uses combinatorial barcodes made up for three 10bp segments which are at the end of the R2 read. Demultiplexing these data results in the barcode being moved to the sequence ID using a pound (#) sign between the sequence ID and barcode, with the barcode recoded in the 1_2_3 format, where each segment is an integer.

stLFR FASTQ data format
stLFR FASTQ data format

  • depending on the link sequence between segments, will be either the last 54bp or 42bp of the R2 read
    • 54 base barcode: 10+6+10+18+10
    • 42 base barcode: 10+6+10+6+10
  • barcode appended to sequence header with # sign
    • e.g. @A003432423434:1:324#12_432_1
  • advertised to have a capacity over 3.6 billion, with up to 50 million per sample (actual results may vary)

One of the presently available commercial linked-read options. TELLseq data is very similar to 10X, except the barcode is 18bp long and contained in the I1 read that Illumina provides with the standard R1 and R2 reads. The barcode gets appended in the read header using a colon (:).

Haplotagging FASTQ data format
Haplotagging FASTQ data format

  • barcode is the first 18bp of the I1 read
  • barcode is appended to sequence header
    • e.g. @A00234534562:1:544:AATTATACCACAGCGGTA
  • advertised to have a capacity over 2 billion barcodes, but realistically use <24 million

The elder of the bunch and also a discontinued commercial product. 10X-style FASTQ files have the linked-read barcode as the first 16bp of the forward (R1) read. For these data to be compatible with the 10X LongRanger suite, the barcode must stay in the read. Moving the first 16bp into the read header breaks LongRanger compatibility.

10X FASTQ data format
10X FASTQ data format

  • barcode is the first 16bp of the R1 read
  • barcode stays in the sequence data for LongRanger compatibility
  • limited to ~4.7 million barcodes

Barcode thresholds

By the nature of linked read technologies, there will (almost always) be more DNA fragments than unique barcodes for them. As a result, it's common for barcodes to reappear in sequences. Rather than incorrectly assume that all sequences/alignments with the same barcode originated from the same orignal DNA molecule, linked-read aware programs include a threshold parameter to determine a "cutoff" distance between alignments with the same barcode. This parameter can be interpreted as "if a barcode appears more than X base pairs away from the same barcode (on the same contig), then we'll consider them as originating from different molecules." If this threshold is lower, then you are being more strict and indicating that alignments sharing barcodes must be closer together to be considered originating from the same DNA molecule. Conversely, a higher threshold indicates you are being more lax and indicating barcodes can be further away from each other and still be considered originating from the same DNA molecule. A threshold of 50kb-150kb is considered a decent balance, but you should choose larger/smaller values if you have evidence to support them.

Molecule origin is determined by the distance between alignments with the same barcode relative to the specified threshold
Molecule origin is determined by the distance between alignments with the same barcode relative to the specified threshold
Alignment distance Inferred origin
less than threshold same molecule
greater than threshold different molecules