Quality Trim Sequences
- at least 2 cores/threads available
- paired-end fastq sequence files
❤️
gzipped recommended
- sample names: a-z 0-9 . _ - case insensitive
- forward: _F .F .1 _1 _R1_001 .R1_001 _R1 .R1
- reverse: _R .R .2 _2 _R2_001 .R2_001 _R2 .R2
- fastq extension: .fq .fastq case insensitive
Raw sequences are not suitable for downstream analyses. They have sequencing adapters, index sequences, regions of poor quality, etc. The first step of any genetic sequence analyses is to remove these adapters and trim poor quality data. You can remove adapters, remove duplicates, and quality trim sequences using the qc module:
harpy qc OPTIONS... INPUTS...
harpy qc --threads 20 -a auto Sequences_Raw/
Running Options
In addition to the common runtime options , the qc module is configured using these command-line arguments:
By default, this workflow will only quality-trim the sequences.
Deduplicate reads
not recommended
You can opt-in to have fastp deduplicate optical (PCR) duplicates. It's generally not recommended to perform deduplication during quality-checking,
as the
align
workflows use the linked-read barcode to more accurately tag reads as duplicates.
Trim adapters
recommended
You can opt-in to find and remove adapter content in sequences.
- accepts
autofor automatic adapter detection and removal - accepts a FASTA file of adapter sequences
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT
>polyA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
In the event you need the forward and reverse reads trimmed down to different read lengths, this can be achieved by
setting -M (--max-length) to the length you want the forward reads trimmed down to (e.g. -M 125), then specify an extra
fastp parameter with -x "--max_len2 VAL" to set the maximum length of the reverse reads to VAL, e.g. -x "--max_len2 130".
In practice that would look like:
harpy qc -M 150 -x "--max_len2 125" -a data/fastq/
QC Workflow
Fastp is an ultra-fast all-in-one adapter remover, deduplicator, and quality trimmer. Harpy uses it to remove adapters, low-quality bases, and trim sequences down to a particular length (default 150bp). Harpy uses the fastp overlap analysis to identify adapters for removal and a sliding window
graph LR
subgraph Inputs
F[FASTQ files]:::clean
end
Inputs-->A:::clean
A([fastp]) --> B([count barcodes]):::clean
style Inputs fill:#f0f0f0,stroke:#e8e8e8,stroke-width:2px,rx:10px,ry:10px
classDef clean fill:#f5f6f9,stroke:#b7c9ef,stroke-width:2pxThe default output directory is QC with the folder structure below. Sample1 and Sample2 are generic sample names for demonstration purposes.
The resulting folder also includes a workflow directory (not shown) with workflow-relevant runtime files and information.
QC/
├── Sample1.R1.fq.gz
├── Sample1.R2.fq.gz
├── Sample2.R1.fq.gz
├── Sample2.R2.fq.gz
├── reports
│ ├── Sample1.html
│ ├── Sample2.html
│ ├── summary.bx.valid.html
│ └── trim.report.html
└── logs
├── err
│ ├── Sample1.log
│ └── Sample2.log
└── json
├── Sample1.fastp.json
└── Sample2.fastp.json
By default, Harpy runs fastp with these parameters (excluding inputs and outputs):
fastp --trim_poly_g --cut_right
The list of all fastp command line options is quite extensive and would
be cumbersome to print here. See the list of options in the fastp documentation.