The simulation process

Or algorithm, if you want to be fancy about it. Note that mentions of "contig" below are synonymous with "chromosome" if your input FASTA files are chromosome-scale.

Mimick 2.0 had a complete overhaul that rewrote the entire simulation process and we detail that process below. This description will ignore all the checks and validations Mimick does before beginning simulation because it's more of a user-experience technical detail and not directly relevant to simulation itself.

%%{init: {"themeVariables": { "lineColor": "#C9C9C9", "mainBkg": "#f5f6f9" }}}%%
graph LR
    A([process input files]) --> step1
    step1(pick barcode):::clean --> step2(number of molecules)
    step2 --> step3(determine molecule source)
    step3 --> step4(create molecules)
    step4 --> step5(simulate reads)
    step5 --> stepx(convert reads format)
    step5 --> step6(update inventory)
    step6 -->| break if all targets are reached | step1

0: Parse the FASTA file(s)

The FASTA files are processed into schema that contain characteristics for each contig, along with the sequence in it. These schema are part of the recipes that get processed during simulation. Schema contain information such as the sequence length (adjusted for ambiguous bases), haplotype number, reads per molecule, and other important information on what needs to be done for that contig (or interval) for that haplotype. They also contain the target number of reads for that contig for that haplotype and a tracker for how many reads have already been generated. They look like this:

haplotype: 1
chrom: Contig1
start: 1
end: 200000
read_length: 150.0
read_pairs_per_mol: 80.0
reads_current: 0
reads_required: 10000
mol_length: 80000
mol_coverage: 0.3
singletons: 0.5
sequence: CTTCACCGAGCTTGCTTCACTTGGTATCGGG... (length = 200000)

These schema are also used to generate the molecule recipes that get fed into the read simulator (wgsim). Mimick accepts an option BED file of intervals, which would restrict the schema to those intervals; if a BED file isn't provided (totally fine), Mimick assumes you want every contig of your FASTA file(s) to have reads simulated. So, if you have two FASTA files, each with 3 contigs and no BED file suggesting otherwise, Mimick will produce 2 * 3 schema (haplotypes * contigs). The schema are internal objects held in memory, not files you will be able to browse.

The loop

1: Pick a barcode

Whether you chose to have barcodes generated or provided your own, Mimick picks the first one and also generates an output version of it. Since input barcodes are always nucleotides, the barcodes will have a corresponding haplotagging or stLFR analogue created if that's the desired output. You can think of the barcode as the oligo-covered bead in TELLseq/stLFR/haplotagging chemistries.

barcode = "ATAGGAGGACCAGGA"
# if output is 10X or TELLseq
output_barcode = barcode
# if output is stLFR
output_barcode = "1_32_441"
# if output is haplotagging
output_barcode = "A01C23B01D83"

2: Making the molecule recipes

Based on the --molecules-per parameter, Mimick will decide how many unrelated molecules will be associated with the barcode. Then, it's a matter of randomly choosing (with replacement) which schema to make molecules from. Remember, each contig for each haplotype has its own schema, so unrelated molecules can come from anywhere, which is a very important feature of these simulations. The "molecules" are just recipes describing which contig/haplotype, which section of it, how many paired reads need to be generated from it to meet --molecule-coverage targets, etc. The creation of a recipe also ends with Mimick writing a FASTA file of the "molecule" that will be submitted for read simulation. There are a few criteria that need to be met for a molecule:

  • must be at least 650bp (a minimum required for wgsim)
  • can't be larger than the source contig/interval
  • start/end positions cannot exceed those of the source contig/interval

The number of reads are calculated based on --molecule-coverage and the molecule size, with a minimum of 2 to prevent singletons. If a value >0 is set for --singletons, then there is that percent chance the number of paired reads are overwritten to be 1 (e.g. --singletons 0.5 = 50% chance of singletons for each molecule).

haplotype: 2
fasta: /path/to/temp/molecules/molecule.fa
output_basename: hapX.mol_id.barcode
chrom: Contig2
start: 5277
end: 54077
barcode: GACCCAGACCCAGACCCAGACCCA
output_barcode: A01C01B01D01
mol_id: 1422882321
read_count: 1

3: Submitting the molecule recipes for simulation

This is the part that's multithreaded. Once we have a molecule recipe and its associated fasta file, Mimick hands the information over to wgsim via pywgsim, where the fasta file will then be the input "genome" from which the software will randomly generate the target number of reads for that molecule. The reads that are simulated never actually have the bacode on them-- it's only if --output-type 10x that the barcode is added inline to R1 during X.

4: Monitor schema targets

The number of reads that were generated for every molecule are added to that molecule's source schema to track the number of reads already produced for that contig for that haplotype. Once a schema reaches its reads target, that schema will be removed from the list of schema that are randomly sampled to determine molecules in Step 2. This ensures that read --coverage is honored.

5: Repeat until all schema read targets are met

Once there are no more schema left to sample, simulation is done!

X: Convert and append reads

A separate concurrent process converts the reads simulated from a molecule into the format specified by --output-type and writes the reads to final R1 and R2 FASTQ files.