Standard Linked-Read Format


Generated on July 07, 2026

Table of Contents

  1. Linked Reads
  2. Standard / LASTQ
  3. 10X
  4. Haplotagging
  5. stLFR
  6. TELLseq

Linked Reads

Linked reads are short-read (e.g. Illumina) data. What makes them different from other kinds of sequencing data is that they contain an added DNA segment ("barcode") that lets you associate sequences as having originated from a single DNA molecule. That means 4 sequences that all contain the same linked-read barcode can be inferred as having originated from the same original DNA molecule. Different barcode = different molecule of origin. If the sequences with the same barcode would map near the same genomic region during sequence alignment, we would know that each of those reads originated from a single DNA fragment from a single homologous chromosome from a single cell, which is effectively built-in phase information.

What do they look like?

Linked-read sequence data appears as you might expect it, encoded in a FASTQ file. The first processing step of linked-read data is demultiplexing to split the raw Illumina-generated batch FASTQ file into samples (if multisample) and identify/validate the linked-read barcode on every sequence. For 10X data, the barcode would stay inline with the sequence (to make it LongRanger compatible), but for other varieties (haplotagging, stLFR, etc.) you would also remove the barcode from the sequence and preserve it somewhere in the read header. The demultiplexing process is generally similar between non-10X linked-read technologies: a nucleotide barcode sequence gets identified and moved from the sequence line to the read header with some kind of platform-specific notation. The diagram below preserves the nucleotide barcode under the OX:Z tag and recodes it under BX:Z using the haplotagging "ACBD" segment format, however it would also be valid to just keep the nucleotide barcode under BX:Z. Linked-read software is variable in its flexibility towards barcode formatting.

Linked-read varieties

There are a handful of linked-read sample preparation methods, but that's largely an implementation detail. All of those methods are laboratory procedures to take genomic DNA and do the necessary modifications to fragment long DNA molecules, tag the resulting fragments with the same DNA barcode, then add the necessary Illumina adapters. It's not unlike the different RAD flavors (e.g. EZrad, ddRAD, 2B-rad)-- they all give you RAD data in the end, but vary in how you get there in terms of cost and bench time.

Always Usable Data

Unlike some other sample preparation methods (cough cough mate-pair), linked-read data is whole genome sequencing (WGS). What that means is that whether you use the linked-read information or not, the data will always be standard and viable WGS compatible with whatever you would use WGS for. It's WGS, but with a little extra info that goes a long way.

Standard / LASTQ

A standardized platform-agnostic and future-proof format

The Standard (LASTQ) format guarantees BX:Z and VX:i SAM tags that encode the barcode and it's validity. This format is universal and agnostic to all existing linked-read varieties and their particulars. It is 100% compliant with comment transfer during alignment and trivial to parse once in SAM format.

This format makes it the responsibility of the early data processing software (as early as demultiplexing) to encode the data in this format for downstream processing. Our hope is that this flexible htslib-compliant format gets widespread adoptions to reduce the fragmentation in the software ecosystem and reduce the need for file format conversions. It also creates a blueprint for a generic file encoding for any new linked-read methods that are being developed or can be developed in the future.

Specification

  • BX:Z tag to record the barcode, the format of which is irrelevant

    • it could be haplotagging ACBD, stLFR 1_2_3, nucleotides, whatever
  • VX:i tag to record if the corresponding barcode is valid

    VX tagtag valuedefinition
    VX:i:00barcode is invalid
    VX:i:11varcode is valid
  • Uses older CASAVA format (/1 or /2) to identify forward/reverse sequence

    • suffixed at the end of the sequence ID, without spaces
    • e.g., @A00470:481:HNYFWDRX2:1:2101:29532:1063/1
  • Comments are SAM TAG:TYPE:VALUE format and tab-separated see below

  • standard FASTQ naming conventions:

    • .fastq or .fq
    • .fastq.gz or .fq.gz if b/gzipped
    • .F or .R1 to indicate it's read 1 (forward read)
    • .R or .R2 to indicate it's read 2 (reverse read)
    • e.g., sample_1.R1.fq.gz

Despite the half-serious name LASTQ, standard-format files are FASTQ files and their naming conventions should follow FASTQ conventions exactly.

FASTQ example

stLFR style FASTQ header with a valid barcode

@A00470:481:HNYFWDRX2:1:2101:29532:1063/1 BX:Z:45_11_361 VX:i:1

haplotagging style FASTQ header with an invalid barcode

@A00470:481:HNYFWDRX2:1:2101:29532:1063/1 BX:Z:A78C00B14D96 VX:i:0

SAM/BAM example

haplotagging style SAM record with a valid barcode

A00470:481:HNYFWDRX2:1:2229:29912:29778 99      2R      1222    40      19S80M  =   1500     428     AGATGTGTATAAGAGACAGAGTTATGTCATTTTAAGCGGTCAAAATGGGTGAATTTCCGATTTCAAGTAATAGGCGAACTCAAGATACCTTCTACAGAT  FFFFFFFFFFFFFFFFF:FFFFF:FFFFF:FFFF:FFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:,FFFFFFF:FFFFF  NM:i:0  MD:Z:80 MC:Z:150M       AS:i:80      XS:i:80 RG:Z:sample1    MI:i:1  VX:i:1  BX:Z:A55C67B91D96

nucleotide (TELLseq/10X) style SAM record with an invalid barcode

A00470:481:HNYFWDRX2:1:2229:29912:29778 99      2R      1222    40      19S80M  =   1500     428     AGATGTGTATAAGAGACAGAGTTATGTCATTTTAAGCGGTCAAAATGGGTGAATTTCCGATTTCAAGTAATAGGCGAACTCAAGATACCTTCTACAGAT  FFFFFFFFFFFFFFFFF:FFFFF:FFFFF:FFFF:FFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:,FFFFFFF:FFFFF  NM:i:0  MD:Z:80 MC:Z:150M       AS:i:80      XS:i:80 RG:Z:sample1    MI:i:1  VX:i:0  BX:Z:TACANNNCACAGAG

SAM Tag Specification

Valid SAM tags take the form TAG:TYPE:VALUE, which are discussed here in further detail. The official SAM spec for tags can be found here.

TAG

All SAM tags are 2 capital alphanumeric characters, like the BX in BX:Z. HTSlib has established standard definitions for some tags (see below), which means you should not repurpose those tags or populate them with anything other than what the SAM spec has established them to be.

TYPE

All SAM tags require a single case-sensitive character to specify what the data type is. The most common ones you will see are Z and i (e.g., BX:Z, VX:i). For convenience, these are the SAM spec type definitions:

characterdata type
Acharacter
Bgeneral array
freal number
Hhexadecimal array
iinteger
Zstring

Reserved Tags

These are the tags resereved by the SAM spec and cannot be used for anything other than what they are described for. This also means you cannot change tag types. For example, AM:i is a standard SAM tag, which means it cannot take any other form like AM:Z, AM:H, etc. Even if a record does not contain an AM:i tag, adding any variant of it, in terms of data type or the meaning of the value it encodes, is very likely to break compatibility with tools that read SAM tags.

TAGTYPEDescription
AMiThe smallest template-independent mapping quality in the template
ASiAlignment score generated by aligner
BCZBarcode sequence identifying the sample
BQZOffset to base alignment quality (BAQ)
BZZPhred quality of the unique molecular barcode bases in the OX tag
CBZCell identifier
CCZReference name of the next hit
CGB,IBAM only: CIGAR in BAM’s binary encoding if (and only if) it consists of >65535 operators
CMiEdit distance between the color sequence and the color reference (see also NM)
COZFree-text comments
CPiLeftmost coordinate of the next hit
CQZColor read base qualities
CRZCellular barcode sequence bases (uncorrected)
CSZColor read sequence
CTZComplete read annotation tag, used for consensus annotation dummy features
CYZPhred quality of the cellular barcode sequence in the CR tag
E2ZThe 2nd most likely base calls
FIiThe index of segment in the template
FSZSegment suffix
FZB,SFlow signal intensities
GC?Reserved for backwards compatibility reasons
GQ?Reserved for backwards compatibility reasons
GS?Reserved for backwards compatibility reasons
H0iNumber of perfect hit
H1iNumber of 1-difference hits (see also NM)
H2iNumber of 2-difference hits
HIiQuery hit index
IHiQuery hit total count
LBZLibrary
MCZCIGAR string for mate/next segment
MDZString encoding mismatched and deleted reference bases
MF?Reserved for backwards compatibility reasons
MIZMolecular identifier; a string that uniquely identifies the molecule from which the record was derived
MLB,CBase modification probabilities
MMZBase modifications / methylation
MNiLength of sequence at the time MM and ML were produced
MQiMapping quality of the mate/next segment
NHiNumber of reported alignments that contain the query in the current record
NMiEdit distance to the reference
OAZOriginal alignment
OCZOriginal CIGAR (deprecated; use OA instead)
OPiOriginal mapping position (deprecated; use OA instead)
OQZOriginal base quality
OXZOriginal unique molecular barcode bases
PGZProgram
PQiPhred likelihood of the template
PTZRead annotations for parts of the padded read sequence
PUZPlatform unit
Q2ZPhred quality of the mate/next segment sequence in the R2 tag
QTZPhred quality of the sample barcode sequence in the BC tag
QXZQuality score of the unique molecular identifier in the RX tag
R2ZSequence of the mate/next segment in the template
RGZRead group
RT?Reserved for backwards compatibility reasons
RXZSequence bases of the (possibly corrected) unique molecular identifier
S2?Reserved for backwards compatibility reasons
SAZOther canonical alignments in a chimeric alignment
SMiTemplate-independent mapping quality
SQ?Reserved for backwards compatibility reasons
TCiThe number of segments in the template
TSATranscript strand
U2ZPhred probability of the 2nd call being wrong conditional on the best being wrong
UQiPhred likelihood of the segment, conditional on the mapping being correct

10X

10X Genomics Linked Reads

The elder of the bunch and also a discontinued commercial product. 10X-style FASTQ files have the linked-read barcode as the first 16bp of the forward (R1) read. For these data to be compatible with the 10X LongRanger suite, the barcode must stay in the read. Moving the first 16bp into the read header breaks LongRanger compatibility.

Specification

  • barcode is the first 16bp of the R1 read
  • barcode stays in the sequence data for LongRanger compatibility
  • limited to ~4.7 million barcodes

Haplotagging

Unlike the other listed chemistries, haplotagging is a non-commercial (DIY) linked-read chemistry. Haplotagging barcodes are combinatorial and are made up of four 6bp segments. Two of these segments ("A" and "C") are the first 12bp of the I1 read and the other two ("B" and "D") are the first 12bp of the I2 read, both of which are provided by Illumina for standard sequencing runs. Because of this segment design, there are 96^4 (~84 million) possible barcode combinations (~900,000 per sample). The barcodes are stored in the sequence header under the BX:Z SAM tag, recoded in their "ACBD" format.

Specification

  • 4 barcode segments
    • A segment is the first 6bp of the I1 read
    • C segment is the next 6bp of the I1 read (7-12)
    • B segment is the first 6bp of the I2 read
    • D segment is the next 6bp of the I2 read (7-12)
  • barcode stored as BX:Z tag in the read header in ACBD format
    • e.g. @A003432423434:1:324 BX:Z:A45C01B84D21
  • invalid barcode segment encoded with 00 (e.g., C00)

stLFR

Single-Tube Long Fragment Reads (stLFR)

Another of the presently available commercial linked-read options. stLFR data uses combinatorial barcodes made up for three 10bp segments which are at the end of the R2 read. Demultiplexing these data results in the barcode being moved to the sequence ID using a pound (#) sign between the sequence ID and barcode, with the barcode recoded in the 1_2_3 format, where each segment is an integer.

Specification

  • depending on the link sequence between segments, will be either the last 54bp or 42bp of the R2 read
    • 54 base barcode: 10+6+10+18+10
    • 42 base barcode: 10+6+10+6+10
  • barcode appended to sequence header with # sign
    • e.g. @A003432423434:1:324#12_432_1
  • invalid barcode segment encoded as 0 (e.g., 1_0_29)
  • advertised to have a capacity over 3.6 billion, with up to 50 million per sample (actual results may vary)

TELLseq

Transposase Enzyme-Linked Long-read Sequencing

One of the presently available commercial linked-read options. TELLseq data is very similar to 10X, except the barcode is 18bp long and contained in the I1 read that Illumina provides with the standard R1 and R2 reads. The barcode gets appended in the read header using a colon (:).

Specification

  • barcode is the first 18bp of the I1 read
  • barcode is appended to sequence header
    • e.g. @A00234534562:1:544:AATTATACCACAGCGGTA
  • invalid barcode contains at least one N character
  • advertised to have a capacity over 2 billion barcodes, but realistically use <24 million

© 2026 Standard Linked-Read Format