# Quality Trim Sequences

Raw sequences are not suitable for downstream analyses. They have sequencing adapters, index sequences, regions of poor quality, etc. The first step of any genetic sequence analyses is to remove these adapters and trim poor quality data. You can remove adapters, remove duplicates, deconvolve, and quality trim sequences using the qc module:

harpy qc OPTIONS... INPUTS...

harpy qc --threads 20 -a auto Sequences_Raw/ 

In addition to the common runtime options , the qc module is configured using these command-line arguments:

By default, this workflow will only quality-trim the sequences. You can also opt-in to:

• find and remove optical (PCR) duplicates
• resolve situations where reads from different molecules have the same barcode (see deconvolve )
• find and remove sequencing adapters recommended
  • accepts auto for automatic adapter detection and removal
  • accepts a FASTA file of adapter sequences
    example FASTA file of adapters

    >Illumina TruSeq Adapter Read 1
    AGATCGGAAGAGCACACGTCTGAACTCCAGTCA
    >Illumina TruSeq Adapter Read 2
    AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT
    >polyA
    AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA

Fastp is an ultra-fast all-in-one adapter remover, deduplicator, and quality trimmer. Harpy uses it to remove adapters, low-quality bases, and trim sequences down to a particular length (default 150bp). Harpy uses the fastp overlap analysis to identify adapters for removal and a sliding window approach (--cut-right) to identify low quality bases. The workflow is quite simple.

graph LR
    subgraph Inputs
        F[FASTQ files]:::clean
    end
    Inputs-->A:::clean
    A([fastp]) --> B([count barcodes]):::clean
    A-->|--deconvolve|C([QuickDeconvolution]):::clean
    style Inputs fill:#f0f0f0,stroke:#e8e8e8,stroke-width:2px
    classDef clean fill:#f5f6f9,stroke:#b7c9ef,stroke-width:2px

The default output directory is QC with the folder structure below. Sample1 and Sample2 are generic sample names for demonstration purposes. The resulting folder also includes a workflow directory (not shown) with workflow-relevant runtime files and information.

QC/
├── Sample1.R1.fq.gz
├── Sample1.R2.fq.gz
├── Sample2.R1.fq.gz
├── Sample2.R2.fq.gz
├── reports
│   ├── Sample1.html
│   ├── Sample2.html
│   ├── summary.bx.valid.html
│   └── trim.report.html
└── logs
    ├── err
    │   ├── Sample1.log
    │   └── Sample2.log
    └── json
        ├── Sample1.fastp.json
        └── Sample2.fastp.json

item	description
*.R1.fq.gz	quality trimmed forward reads of the samples
*.R1.fq.gz	quality trimmed reverse reads of the samples
logs/	all debug/diagnostic files that aren't the trimmed reads fastp creates
logs/err	what fastp prints to stderr when running
reports/*.html	interactive html reports fastp creates from quality trimming
reports/trim.report.html	a report generated by multiqc summarizing the quality trimming results
reports/summary.bx.valid.html	a report detailing valid vs invalid barcodes and the segments causing invalidation
logs/json	json representation of the data fastp uses to create the html reports

By default, Harpy runs fastp with these parameters (excluding inputs and outputs):

fastp --trim_poly_g --cut_right

The list of all fastp command line options is quite extensive and would be cumbersome to print here. See the list of options in the fastp documentation.

These are the summary reports Harpy generates for this workflow. You may right-click the images and open them in a new tab if you wish to see the examples in better detail.

fastp reports

Trimming and QC

BX validation

Reports of all QC activities performed by fastp (fastp creates this)

Aggregates the metrics FASTP generates for every sample during QC.

Reports the number of valid/invalid barcodes in the sequences and the segments contributing to invalidation.